Homework 4: DeepBind-style 1D CNN for Motif Discovery (Synthetic Dataset)¶

(Due: Monday April 06, 2026 before class)¶

Structure¶

  1. Set Up
  2. Dataset generation (synthetic sequences with implanted motif)
  3. Prepare data for Keras
  4. Model implementation (1D CNN)
  5. Training & evaluation (ROC AUC)
  6. Motif extraction
  7. Motif visualization
  8. Advanced Analysis

Run cells sequentially. The notebook contains starter code and exercises to complete.

Submit the completed notebook and a short PDF report with your answers and interpretations. There are 6 Questions.¶

  • This notebook contains starter code: training parameters, hyperparameter search, and deeper analyses are encouraged to be updated.
  • The dataset generation is reproducible and small by default to allow quick runs.

1. Setup: imports and utility functions¶

In [1]:
import numpy as np
import matplotlib.pyplot as plt
import random
from sklearn.metrics import roc_auc_score, roc_curve, precision_recall_curve, auc
import tensorflow as tf
from tensorflow.keras import layers, models, optimizers, losses, callbacks

np.random.seed(42)
random.seed(42)

# Simple one-hot encoding utilities
BASES = ['A','C','G','T']
_base_to_idx = {b:i for i,b in enumerate(BASES)}

def one_hot_encode_seqs(seqs):
    """Encode a list of uppercase DNA sequences (A,C,G,T) to shape (N, L, 4)."""
    N = len(seqs)
    L = len(seqs[0])
    arr = np.zeros((N, L, 4), dtype=np.float32)
    for i,s in enumerate(seqs):
        for j,ch in enumerate(s):
            arr[i,j,_base_to_idx.get(ch,'A')] = 1.0
    return arr


def seqs_from_onehot(X):
    # convert back to seqs by argmax
    seqs = []
    for i in range(X.shape[0]):
        seq = ''.join(BASES[int(np.argmax(X[i,j]))] for j in range(X.shape[1]))
        seqs.append(seq)
    return seqs

2. Synthetic dataset generation¶

By default the notebook provides a functioning generator that creates sequences of length 101, implants a motif at a random position in positives, and returns train/val/test splits.

Exercise: change motif, embed multiple motifs, or vary sequence length for analysis.

In [2]:
# Synthetic data generator

def generate_synthetic_dataset(num_pos=2000, num_neg=2000, seq_len=101, motif='ACGTG', motif_prob=1.0, random_seed=42):
    """Generate synthetic sequences.
    - num_pos: number of positive examples
    - num_neg: number of negative examples
    - seq_len: length of each sequence
    - motif: motif string to implant in positives
    - motif_prob: probability that a positive contains the motif (allows noisy labels)
    Returns: (seqs, labels)
    """
    rng = np.random.RandomState(random_seed)
    def random_seq(L):
        return ''.join(rng.choice(BASES) for _ in range(L))

    pos_seqs = []
    for _ in range(num_pos):
        s = list(random_seq(seq_len))
        if rng.rand() <= motif_prob:
            # implant motif at random position so it fits
            k = len(motif)
            start = rng.randint(0, seq_len - k + 1)
            s[start:start+k] = list(motif)
        pos_seqs.append(''.join(s))

    neg_seqs = [random_seq(seq_len) for _ in range(num_neg)]

    seqs = pos_seqs + neg_seqs
    labels = np.array([1]*len(pos_seqs) + [0]*len(neg_seqs), dtype=np.int32)

    # shuffle
    perm = rng.permutation(len(seqs))
    seqs = [seqs[i] for i in perm]
    labels = labels[perm]
    return seqs, labels

# Quick test
seqs, labels = generate_synthetic_dataset(num_pos=10, num_neg=10)
print('Example positive seq:', seqs[0], 'label', labels[0])
Example positive seq: TCCCTGCTCACCGTGGGGGCGGTACCCGGGTAGATCGAAGCCCTAAATATCGAACGTGCCGTTATGCAACTCTCGTGACAAAACACCGTTCGCCCGTGAGG label 0

3. Prepare data for Keras¶

One-hot encode sequences and split into train/val/test. By default we use an 80/10/10 split.

In [3]:
# Prepare dataset

SEQ_LEN = 101
MOTIF = 'ACGTG'

seqs, labels = generate_synthetic_dataset(num_pos=4000, num_neg=4000, seq_len=SEQ_LEN, motif=MOTIF, motif_prob=1.0)

# Train/val/test split
N = len(seqs)
train_end = int(0.8*N)
val_end = int(0.9*N)

train_seqs = seqs[:train_end]
train_y = labels[:train_end]
val_seqs = seqs[train_end:val_end]
val_y = labels[train_end:val_end]
test_seqs = seqs[val_end:]
test_y = labels[val_end:]

X_train = one_hot_encode_seqs(train_seqs)
X_val = one_hot_encode_seqs(val_seqs)
X_test = one_hot_encode_seqs(test_seqs)

print('Shapes:', X_train.shape, X_val.shape, X_test.shape)
print('Train positive fraction:', np.mean(train_y))
Shapes: (6400, 101, 4) (800, 101, 4) (800, 101, 4)
Train positive fraction: 0.49453125

4. Model starter code (1D CNN)¶

It is encouraged to experiment with architecture/hyperparameters. The code below implements a small model with Conv1D + GlobalMaxPooling + Dense output.

In [4]:
def build_deepbind_like_model(input_length, num_filters=16, kernel_size=11, lr=1e-3):
    inp = layers.Input(shape=(input_length, 4))
    x = layers.Conv1D(filters=num_filters, kernel_size=kernel_size, padding='valid', activation='relu')(inp)
    x = layers.GlobalMaxPooling1D()(x)
    x = layers.Dense(32, activation='relu')(x)
    out = layers.Dense(1, activation='sigmoid')(x)
    model = models.Model(inputs=inp, outputs=out)
    model.compile(optimizer=optimizers.Adam(lr), loss=losses.BinaryCrossentropy(), metrics=[])
    return model

model = build_deepbind_like_model(SEQ_LEN, num_filters=16, kernel_size=len(MOTIF))
model.summary()
2026-03-16 13:07:54.642968: I metal_plugin/src/device/metal_device.cc:1154] Metal device set to: Apple M1
2026-03-16 13:07:54.643000: I metal_plugin/src/device/metal_device.cc:296] systemMemory: 16.00 GB
2026-03-16 13:07:54.643004: I metal_plugin/src/device/metal_device.cc:313] maxCacheSize: 5.33 GB
2026-03-16 13:07:54.643037: I tensorflow/core/common_runtime/pluggable_device/pluggable_device_factory.cc:305] Could not identify NUMA node of platform GPU ID 0, defaulting to 0. Your kernel may not have been built with NUMA support.
2026-03-16 13:07:54.643046: I tensorflow/core/common_runtime/pluggable_device/pluggable_device_factory.cc:271] Created TensorFlow device (/job:localhost/replica:0/task:0/device:GPU:0 with 0 MB memory) -> physical PluggableDevice (device: 0, name: METAL, pci bus id: <undefined>)
Model: "functional"
┏━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━┓
┃ Layer (type)                    ┃ Output Shape           ┃       Param # ┃
┡━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━┩
│ input_layer (InputLayer)        │ (None, 101, 4)         │             0 │
├─────────────────────────────────┼────────────────────────┼───────────────┤
│ conv1d (Conv1D)                 │ (None, 97, 16)         │           336 │
├─────────────────────────────────┼────────────────────────┼───────────────┤
│ global_max_pooling1d            │ (None, 16)             │             0 │
│ (GlobalMaxPooling1D)            │                        │               │
├─────────────────────────────────┼────────────────────────┼───────────────┤
│ dense (Dense)                   │ (None, 32)             │           544 │
├─────────────────────────────────┼────────────────────────┼───────────────┤
│ dense_1 (Dense)                 │ (None, 1)              │            33 │
└─────────────────────────────────┴────────────────────────┴───────────────┘
 Total params: 913 (3.57 KB)
 Trainable params: 913 (3.57 KB)
 Non-trainable params: 0 (0.00 B)

Question¶

  1. Explain the number of parameters and hyper-parameters in your model.

5. Training¶

The training below is small and quick for homework. You are encouraged to run longer training for better performance and experimentation.

In [5]:
EPOCHS = 10
BATCH_SIZE = 128

es = callbacks.EarlyStopping(monitor='val_loss', patience=3, restore_best_weights=True)

history = model.fit(X_train, train_y, validation_data=(X_val, val_y), epochs=EPOCHS, batch_size=BATCH_SIZE, callbacks=[es])

# Evaluate on test set
preds = model.predict(X_test).ravel()
roc = roc_auc_score(test_y, preds)
precision, recall, _ = precision_recall_curve(test_y, preds)
pr_auc = auc(recall, precision)
print(f'Test ROC AUC: {roc:.4f}, PR AUC: {pr_auc:.4f}')

# Plot training curves
plt.figure(figsize=(6,3))
plt.plot(history.history['loss'], label='train loss')
plt.plot(history.history['val_loss'], label='val loss')
plt.legend()
plt.title('Loss curves')
plt.show()
Epoch 1/10
2026-03-16 13:12:32.204019: I tensorflow/core/grappler/optimizers/custom_graph_optimizer_registry.cc:117] Plugin optimizer for device_type GPU is enabled.
50/50 ━━━━━━━━━━━━━━━━━━━━ 1s 11ms/step - loss: 0.6900 - val_loss: 0.6821
Epoch 2/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.6821 - val_loss: 0.6689
Epoch 3/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 1s 10ms/step - loss: 0.6613 - val_loss: 0.6297
Epoch 4/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.6187 - val_loss: 0.5682
Epoch 5/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.5447 - val_loss: 0.4923
Epoch 6/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.4765 - val_loss: 0.4326
Epoch 7/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.4146 - val_loss: 0.4051
Epoch 8/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3919 - val_loss: 0.3862
Epoch 9/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3703 - val_loss: 0.3688
Epoch 10/10
50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3574 - val_loss: 0.3569
25/25 ━━━━━━━━━━━━━━━━━━━━ 0s 2ms/step 
Test ROC AUC: 0.9047, PR AUC: 0.8651
No description has been provided for this image

6. Motif extraction from convolutional filters¶

We will extract high-activating k-mers for each filter and build PWMs. The code below finds top activating windows (by scanning each sequence), collects the k-mers, and computes a position frequency matrix.

In [8]:
import heapq
from collections import Counter

def get_conv_layer_output(model, X, layer_index=1):
    # Return activations from conv layer for input X (no pooling)
    conv_model = models.Model(inputs=model.input, outputs=model.layers[layer_index].output)
    return conv_model.predict(X)

conv_out_train = get_conv_layer_output(model, X_train, layer_index=1)
print('Conv output shape (train):', conv_out_train.shape)

# For each filter, find windows with top activations across the dataset
KERNEL = model.layers[1].kernel_size[0]
NUM_TOP = max(50, int(0.01 * X_train.shape[0]))  # top 1% or at least 50

# We'll scan convolution outputs (before pooling) and record the positions

filter_kmers = {f: [] for f in range(conv_out_train.shape[-1])}

for i in range(X_train.shape[0]):
    # conv_out_train[i] shape: (L_out, num_filters)
    for f in range(conv_out_train.shape[-1]):
        # find the max activation position for filter f in this sequence
        # we'll collect top-N across sequences later
        pass

# More systematic approach: for each filter, keep a heap of top activations with (score, seq_index, pos)
heaps = {f: [] for f in range(conv_out_train.shape[-1])}

for i in range(X_train.shape[0]):
    # conv_out_train[i] has shape (L_out, num_filters)
    arr = conv_out_train[i]  # numpy array
    L_out = arr.shape[0]
    for pos in range(L_out):
        for f in range(arr.shape[1]):
            score = arr[pos, f]
            heap = heaps[f]
            if len(heap) < NUM_TOP:
                heapq.heappush(heap, (score, i, pos))
            else:
                if score > heap[0][0]:
                    heapq.heapreplace(heap, (score, i, pos))

# Extract k-mers
for f, heap in heaps.items():
    top = sorted(heap, reverse=True)
    kmers = []
    for (score, i, pos) in top:
        # map pos in conv output to original sequence coordinate
        # For 'valid' conv, pos corresponds to start index in original sequence
        start = pos
        kmer = train_seqs[i][start:start+KERNEL]
        kmers.append(kmer)
    filter_kmers[f] = kmers

# Quick check for filter 0
for f in range(min(4, len(filter_kmers))):
    print(f'Filter {f}, top kmers (first 10):', filter_kmers[f][:10])
200/200 ━━━━━━━━━━━━━━━━━━━━ 0s 1ms/step
Conv output shape (train): (6400, 97, 16)
Filter 0, top kmers (first 10): ['AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG']
Filter 1, top kmers (first 10): ['AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC']
Filter 2, top kmers (first 10): ['TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT']
Filter 3, top kmers (first 10): ['AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT']

7. Build PWMs and plot simple sequence logos¶

(You may use logomaker or create simple barplots. Below is a simple PWM builder and a rudimentary logo via matplotlib.)

In [12]:
def build_pwm(kmers):
    k = len(kmers[0])
    pfm = np.zeros((k,4), dtype=float)
    for s in kmers:
        for i,ch in enumerate(s):
            pfm[i,_base_to_idx[ch]] += 1
    # add pseudocount
    pfm += 1e-6
    pwm = pfm / pfm.sum(axis=1, keepdims=True)
    return pwm
In [10]:
import seaborn as sns
import matplotlib.pyplot as plt
import pandas as pd

def plot_pwm_heatmap(pwm, title="PWM Heatmap"):
    
    df = pd.DataFrame(pwm, columns=BASES)

    plt.figure(figsize=(max(6, pwm.shape[0]/2), 3))
    
    sns.heatmap(
        df.T,                 # transpose for nicer layout
        cmap="viridis",
        vmin=0,
        vmax=1,
        cbar=True
    )

    plt.xlabel("Position")
    plt.ylabel("Base")
    plt.title(title)
    plt.show()
In [13]:
for f in range(min(4, len(filter_kmers))):
    pwm = build_pwm(filter_kmers[f])
    plot_pwm_heatmap(pwm, title=f"Filter {f} PWM")
No description has been provided for this image
No description has been provided for this image
No description has been provided for this image
No description has been provided for this image

Questions¶

  1. Train the model with different kernel sizes (smaller and larger than the motif). Report ROC AUC and PR AUC.
  2. Does the model recover the implanted motif? Show the best-matching filter and its sequence logo.
  3. Try adding Gaussian noise to negative sequences or implant the motif with probability < 1. How do results change?

8 – Advanced Modeling and Biological Extensions (25 pts)¶

Multiple Motifs

Modify dataset:

  • include two different motifs.

  • Allow co-occurrence in some sequences.

Analyze for Question #5 and #6

Questions¶

  1. Does the CNN learn separate filters?
  2. Does it capture motif interactions?