Homework 4: DeepBind-style 1D CNN for Motif Discovery (Synthetic Dataset)¶
(Due: Monday April 06, 2026 before class)¶
Structure¶
- Set Up
- Dataset generation (synthetic sequences with implanted motif)
- Prepare data for Keras
- Model implementation (1D CNN)
- Training & evaluation (ROC AUC)
- Motif extraction
- Motif visualization
- Advanced Analysis
Run cells sequentially. The notebook contains starter code and exercises to complete.
Submit the completed notebook and a short PDF report with your answers and interpretations. There are 6 Questions.¶
- This notebook contains starter code: training parameters, hyperparameter search, and deeper analyses are encouraged to be updated.
- The dataset generation is reproducible and small by default to allow quick runs.
1. Setup: imports and utility functions¶
import numpy as np
import matplotlib.pyplot as plt
import random
from sklearn.metrics import roc_auc_score, roc_curve, precision_recall_curve, auc
import tensorflow as tf
from tensorflow.keras import layers, models, optimizers, losses, callbacks
np.random.seed(42)
random.seed(42)
# Simple one-hot encoding utilities
BASES = ['A','C','G','T']
_base_to_idx = {b:i for i,b in enumerate(BASES)}
def one_hot_encode_seqs(seqs):
"""Encode a list of uppercase DNA sequences (A,C,G,T) to shape (N, L, 4)."""
N = len(seqs)
L = len(seqs[0])
arr = np.zeros((N, L, 4), dtype=np.float32)
for i,s in enumerate(seqs):
for j,ch in enumerate(s):
arr[i,j,_base_to_idx.get(ch,'A')] = 1.0
return arr
def seqs_from_onehot(X):
# convert back to seqs by argmax
seqs = []
for i in range(X.shape[0]):
seq = ''.join(BASES[int(np.argmax(X[i,j]))] for j in range(X.shape[1]))
seqs.append(seq)
return seqs
2. Synthetic dataset generation¶
By default the notebook provides a functioning generator that creates sequences of length 101, implants a motif at a random position in positives, and returns train/val/test splits.
Exercise: change motif, embed multiple motifs, or vary sequence length for analysis.
# Synthetic data generator
def generate_synthetic_dataset(num_pos=2000, num_neg=2000, seq_len=101, motif='ACGTG', motif_prob=1.0, random_seed=42):
"""Generate synthetic sequences.
- num_pos: number of positive examples
- num_neg: number of negative examples
- seq_len: length of each sequence
- motif: motif string to implant in positives
- motif_prob: probability that a positive contains the motif (allows noisy labels)
Returns: (seqs, labels)
"""
rng = np.random.RandomState(random_seed)
def random_seq(L):
return ''.join(rng.choice(BASES) for _ in range(L))
pos_seqs = []
for _ in range(num_pos):
s = list(random_seq(seq_len))
if rng.rand() <= motif_prob:
# implant motif at random position so it fits
k = len(motif)
start = rng.randint(0, seq_len - k + 1)
s[start:start+k] = list(motif)
pos_seqs.append(''.join(s))
neg_seqs = [random_seq(seq_len) for _ in range(num_neg)]
seqs = pos_seqs + neg_seqs
labels = np.array([1]*len(pos_seqs) + [0]*len(neg_seqs), dtype=np.int32)
# shuffle
perm = rng.permutation(len(seqs))
seqs = [seqs[i] for i in perm]
labels = labels[perm]
return seqs, labels
# Quick test
seqs, labels = generate_synthetic_dataset(num_pos=10, num_neg=10)
print('Example positive seq:', seqs[0], 'label', labels[0])
Example positive seq: TCCCTGCTCACCGTGGGGGCGGTACCCGGGTAGATCGAAGCCCTAAATATCGAACGTGCCGTTATGCAACTCTCGTGACAAAACACCGTTCGCCCGTGAGG label 0
3. Prepare data for Keras¶
One-hot encode sequences and split into train/val/test. By default we use an 80/10/10 split.
# Prepare dataset
SEQ_LEN = 101
MOTIF = 'ACGTG'
seqs, labels = generate_synthetic_dataset(num_pos=4000, num_neg=4000, seq_len=SEQ_LEN, motif=MOTIF, motif_prob=1.0)
# Train/val/test split
N = len(seqs)
train_end = int(0.8*N)
val_end = int(0.9*N)
train_seqs = seqs[:train_end]
train_y = labels[:train_end]
val_seqs = seqs[train_end:val_end]
val_y = labels[train_end:val_end]
test_seqs = seqs[val_end:]
test_y = labels[val_end:]
X_train = one_hot_encode_seqs(train_seqs)
X_val = one_hot_encode_seqs(val_seqs)
X_test = one_hot_encode_seqs(test_seqs)
print('Shapes:', X_train.shape, X_val.shape, X_test.shape)
print('Train positive fraction:', np.mean(train_y))
Shapes: (6400, 101, 4) (800, 101, 4) (800, 101, 4) Train positive fraction: 0.49453125
4. Model starter code (1D CNN)¶
It is encouraged to experiment with architecture/hyperparameters. The code below implements a small model with Conv1D + GlobalMaxPooling + Dense output.
def build_deepbind_like_model(input_length, num_filters=16, kernel_size=11, lr=1e-3):
inp = layers.Input(shape=(input_length, 4))
x = layers.Conv1D(filters=num_filters, kernel_size=kernel_size, padding='valid', activation='relu')(inp)
x = layers.GlobalMaxPooling1D()(x)
x = layers.Dense(32, activation='relu')(x)
out = layers.Dense(1, activation='sigmoid')(x)
model = models.Model(inputs=inp, outputs=out)
model.compile(optimizer=optimizers.Adam(lr), loss=losses.BinaryCrossentropy(), metrics=[])
return model
model = build_deepbind_like_model(SEQ_LEN, num_filters=16, kernel_size=len(MOTIF))
model.summary()
2026-03-16 13:07:54.642968: I metal_plugin/src/device/metal_device.cc:1154] Metal device set to: Apple M1 2026-03-16 13:07:54.643000: I metal_plugin/src/device/metal_device.cc:296] systemMemory: 16.00 GB 2026-03-16 13:07:54.643004: I metal_plugin/src/device/metal_device.cc:313] maxCacheSize: 5.33 GB 2026-03-16 13:07:54.643037: I tensorflow/core/common_runtime/pluggable_device/pluggable_device_factory.cc:305] Could not identify NUMA node of platform GPU ID 0, defaulting to 0. Your kernel may not have been built with NUMA support. 2026-03-16 13:07:54.643046: I tensorflow/core/common_runtime/pluggable_device/pluggable_device_factory.cc:271] Created TensorFlow device (/job:localhost/replica:0/task:0/device:GPU:0 with 0 MB memory) -> physical PluggableDevice (device: 0, name: METAL, pci bus id: <undefined>)
Model: "functional"
┏━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━━━━━━━━━━┳━━━━━━━━━━━━━━━┓ ┃ Layer (type) ┃ Output Shape ┃ Param # ┃ ┡━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━━━━━━━━━━╇━━━━━━━━━━━━━━━┩ │ input_layer (InputLayer) │ (None, 101, 4) │ 0 │ ├─────────────────────────────────┼────────────────────────┼───────────────┤ │ conv1d (Conv1D) │ (None, 97, 16) │ 336 │ ├─────────────────────────────────┼────────────────────────┼───────────────┤ │ global_max_pooling1d │ (None, 16) │ 0 │ │ (GlobalMaxPooling1D) │ │ │ ├─────────────────────────────────┼────────────────────────┼───────────────┤ │ dense (Dense) │ (None, 32) │ 544 │ ├─────────────────────────────────┼────────────────────────┼───────────────┤ │ dense_1 (Dense) │ (None, 1) │ 33 │ └─────────────────────────────────┴────────────────────────┴───────────────┘
Total params: 913 (3.57 KB)
Trainable params: 913 (3.57 KB)
Non-trainable params: 0 (0.00 B)
Question¶
- Explain the number of parameters and hyper-parameters in your model.
5. Training¶
The training below is small and quick for homework. You are encouraged to run longer training for better performance and experimentation.
EPOCHS = 10
BATCH_SIZE = 128
es = callbacks.EarlyStopping(monitor='val_loss', patience=3, restore_best_weights=True)
history = model.fit(X_train, train_y, validation_data=(X_val, val_y), epochs=EPOCHS, batch_size=BATCH_SIZE, callbacks=[es])
# Evaluate on test set
preds = model.predict(X_test).ravel()
roc = roc_auc_score(test_y, preds)
precision, recall, _ = precision_recall_curve(test_y, preds)
pr_auc = auc(recall, precision)
print(f'Test ROC AUC: {roc:.4f}, PR AUC: {pr_auc:.4f}')
# Plot training curves
plt.figure(figsize=(6,3))
plt.plot(history.history['loss'], label='train loss')
plt.plot(history.history['val_loss'], label='val loss')
plt.legend()
plt.title('Loss curves')
plt.show()
Epoch 1/10
2026-03-16 13:12:32.204019: I tensorflow/core/grappler/optimizers/custom_graph_optimizer_registry.cc:117] Plugin optimizer for device_type GPU is enabled.
50/50 ━━━━━━━━━━━━━━━━━━━━ 1s 11ms/step - loss: 0.6900 - val_loss: 0.6821 Epoch 2/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.6821 - val_loss: 0.6689 Epoch 3/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 1s 10ms/step - loss: 0.6613 - val_loss: 0.6297 Epoch 4/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.6187 - val_loss: 0.5682 Epoch 5/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.5447 - val_loss: 0.4923 Epoch 6/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.4765 - val_loss: 0.4326 Epoch 7/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.4146 - val_loss: 0.4051 Epoch 8/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3919 - val_loss: 0.3862 Epoch 9/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3703 - val_loss: 0.3688 Epoch 10/10 50/50 ━━━━━━━━━━━━━━━━━━━━ 0s 9ms/step - loss: 0.3574 - val_loss: 0.3569 25/25 ━━━━━━━━━━━━━━━━━━━━ 0s 2ms/step Test ROC AUC: 0.9047, PR AUC: 0.8651
6. Motif extraction from convolutional filters¶
We will extract high-activating k-mers for each filter and build PWMs. The code below finds top activating windows (by scanning each sequence), collects the k-mers, and computes a position frequency matrix.
import heapq
from collections import Counter
def get_conv_layer_output(model, X, layer_index=1):
# Return activations from conv layer for input X (no pooling)
conv_model = models.Model(inputs=model.input, outputs=model.layers[layer_index].output)
return conv_model.predict(X)
conv_out_train = get_conv_layer_output(model, X_train, layer_index=1)
print('Conv output shape (train):', conv_out_train.shape)
# For each filter, find windows with top activations across the dataset
KERNEL = model.layers[1].kernel_size[0]
NUM_TOP = max(50, int(0.01 * X_train.shape[0])) # top 1% or at least 50
# We'll scan convolution outputs (before pooling) and record the positions
filter_kmers = {f: [] for f in range(conv_out_train.shape[-1])}
for i in range(X_train.shape[0]):
# conv_out_train[i] shape: (L_out, num_filters)
for f in range(conv_out_train.shape[-1]):
# find the max activation position for filter f in this sequence
# we'll collect top-N across sequences later
pass
# More systematic approach: for each filter, keep a heap of top activations with (score, seq_index, pos)
heaps = {f: [] for f in range(conv_out_train.shape[-1])}
for i in range(X_train.shape[0]):
# conv_out_train[i] has shape (L_out, num_filters)
arr = conv_out_train[i] # numpy array
L_out = arr.shape[0]
for pos in range(L_out):
for f in range(arr.shape[1]):
score = arr[pos, f]
heap = heaps[f]
if len(heap) < NUM_TOP:
heapq.heappush(heap, (score, i, pos))
else:
if score > heap[0][0]:
heapq.heapreplace(heap, (score, i, pos))
# Extract k-mers
for f, heap in heaps.items():
top = sorted(heap, reverse=True)
kmers = []
for (score, i, pos) in top:
# map pos in conv output to original sequence coordinate
# For 'valid' conv, pos corresponds to start index in original sequence
start = pos
kmer = train_seqs[i][start:start+KERNEL]
kmers.append(kmer)
filter_kmers[f] = kmers
# Quick check for filter 0
for f in range(min(4, len(filter_kmers))):
print(f'Filter {f}, top kmers (first 10):', filter_kmers[f][:10])
200/200 ━━━━━━━━━━━━━━━━━━━━ 0s 1ms/step Conv output shape (train): (6400, 97, 16) Filter 0, top kmers (first 10): ['AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG', 'AGCTG'] Filter 1, top kmers (first 10): ['AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC', 'AGGCC'] Filter 2, top kmers (first 10): ['TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT', 'TTAAT'] Filter 3, top kmers (first 10): ['AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT', 'AACGT']
7. Build PWMs and plot simple sequence logos¶
(You may use logomaker or create simple barplots. Below is a simple PWM builder and a rudimentary logo via matplotlib.)
def build_pwm(kmers):
k = len(kmers[0])
pfm = np.zeros((k,4), dtype=float)
for s in kmers:
for i,ch in enumerate(s):
pfm[i,_base_to_idx[ch]] += 1
# add pseudocount
pfm += 1e-6
pwm = pfm / pfm.sum(axis=1, keepdims=True)
return pwm
import seaborn as sns
import matplotlib.pyplot as plt
import pandas as pd
def plot_pwm_heatmap(pwm, title="PWM Heatmap"):
df = pd.DataFrame(pwm, columns=BASES)
plt.figure(figsize=(max(6, pwm.shape[0]/2), 3))
sns.heatmap(
df.T, # transpose for nicer layout
cmap="viridis",
vmin=0,
vmax=1,
cbar=True
)
plt.xlabel("Position")
plt.ylabel("Base")
plt.title(title)
plt.show()
for f in range(min(4, len(filter_kmers))):
pwm = build_pwm(filter_kmers[f])
plot_pwm_heatmap(pwm, title=f"Filter {f} PWM")
Questions¶
- Train the model with different kernel sizes (smaller and larger than the motif). Report ROC AUC and PR AUC.
- Does the model recover the implanted motif? Show the best-matching filter and its sequence logo.
- Try adding Gaussian noise to negative sequences or implant the motif with probability < 1. How do results change?
8 – Advanced Modeling and Biological Extensions (25 pts)¶
Multiple Motifs
Modify dataset:
include two different motifs.
Allow co-occurrence in some sequences.
Analyze for Question #5 and #6
Questions¶
- Does the CNN learn separate filters?
- Does it capture motif interactions?